DragonFly On-Line Manual Pages

Search: Section:  

faidx(5)                    Bioinformatics formats                    faidx(5)


NAME

       faidx - an index enabling random access to FASTA files


SYNOPSIS

       file.fa.fai, file.fasta.fai


DESCRIPTION

       Using an fai index file in conjunction with a FASTA file containing
       reference sequences enables efficient access to arbitrary regions
       within those reference sequences.  The index file typically has the
       same filename as the corresponding FASTA file, with .fai appended.

       An fai index file is a text file consisting of lines each with five
       TAB-delimited columns:

       NAME        Name of this reference sequence
       LENGTH      Total length of this reference sequence, in bases
       OFFSET      Offset within the FASTA file of this sequence's first base
       LINEBASES   The number of bases on each line
       LINEWIDTH   The number of bytes in each line, including the newline

       The NAME and LENGTH columns contain the same data as would appear in
       the SN and LN fields of a SAM @SQ header for the same reference
       sequence.

       The OFFSET column contains the offset within the FASTA file, in bytes
       starting from zero, of the first base of this reference sequence, i.e.,
       of the character following the newline at the end of the ">" header
       line.  Typically the lines of a fai index file appear in the order in
       which the reference sequences appear in the FASTA file, so .fai files
       are typically sorted according to this column.

       The LINEBASES column contains the number of bases in each of the
       sequence lines that form the body of this reference sequence, apart
       from the final line which may be shorter.  The LINEWIDTH column
       contains the number of bytes in each of the sequence lines (except
       perhaps the final line), thus differing from LINEBASES in that it also
       counts the bytes forming the line terminator.

   FASTA Files
       In order to be indexed with samtools faidx, a FASTA file must be a text
       file of the form

              >name [description...]
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >name [description...]
              ATGCATGCATGCAT
              GCATGCATGCATGC
              [...]

       In particular, each reference sequence must be "well-formatted", i.e.,
       all of its sequence lines must be the same length, apart from the final
       sequence line which may be shorter.  (While this sequence line length
       must be the same within each sequence, it may vary between different
       reference sequences in the same FASTA file.)

       This also means that although the FASTA file may have Unix- or Windows-
       style or other line termination, the newline characters present must be
       consistent, at least within each reference sequence.

       The samtools implementation uses the first word of the ">" header line
       text (i.e., up to the first whitespace character, having skipped any
       initial whitespace after the ">") as the NAME column.


EXAMPLE

       For example, given this FASTA file

              >one
              ATGCATGCATGCATGCATGCATGCATGCAT
              GCATGCATGCATGCATGCATGCATGCATGC
              ATGCAT
              >two another chromosome
              ATGCATGCATGCAT
              GCATGCATGCATGC

       formatted with Unix-style (LF) line termination, the corresponding fai
       index would be

              one   66    5   30   31
              two   28   98   14   15

       If the FASTA file were formatted with Windows-style (CR-LF) line
       termination, the fai index would be

              one   66     6   30   32
              two   28   103   14   16


SEE ALSO

       samtools(1)

       http://en.wikipedia.org/wiki/FASTA_format
              Further description of the FASTA format

htslib                            August 2015                         faidx(5)

Search: Section: