DragonFly On-Line Manual Pages

BP_FLANKS(1)          User Contributed Perl Documentation         BP_FLANKS(1)

NAME
       bp_flanks - finding flanking sequences for a variant in a sequence
       position

SYNOPSIS
         bp_flanks --position POS [-p POS ...]  [--flanklen INT]
                accession | filename

DESCRIPTION
       This script allows you to extract a subsequence around a region of
       interest from an existing sequence. The output if fasta formatted
       sequence entry where the header line contains additional information
       about the location.

OPTIONS
       The script takes one unnamed argument which be either a file name in
       the local file system or a nucleotide sequence accession number.

         -p         Position uses simple nucleotide sequence feature table
         --position notation to define the region of interest, typically a
                    SNP or microsatellite repeat around which the flanks are
                    defined.

                    There can be more than one position option or you can
                    give a comma separated list to one position option.

                    The format of a position is:

                        [id:] int | range | in-between [-]

                    The optional id is the name you want to call the new
                    sequence. If it not given in joins running number to the
                    entry name with an underscore.

                    The position is either a point (e.g. 234), a range (e.g
                    250..300) or insertion point between nucleotides
                    (e.g. 234^235)

                    If the position is not completely within the source
                    sequence the output sequence will be truncated and it
                    will print a warning.

                    The optional hyphen [-] at the end of the position
                    indicates that that you want the retrieved sequence to be
                    in the opposite strand.

         -f         Defaults to 100. This is the length of the nucleotides
         --flanklen sequence retrieved on both sides of the given position.

                    If the source file does not contain

OUTPUT FORMAT
       The output is a fasta formatted entry where the description file
       contains tag=value pairs for information about where in the original
       sequence the subsequence was taken.

       The ID of the fasta entry is the name given at the command line joined
       by hyphen to the filename or accesion of the source sequence. If no id
       is given a series of consequtive integers is used.

       The tag=value pairs are:

       oripos=int
          position in the source file

       strand=1|-1
          strand of the sequence compared to the source sequence

       allelepos=int
          position of the region of interest in the current entry.  The tag is
          the same as used by dbSNP@NCBI

       The sequence highlights the allele variant position by showing it in
       upper case and rest of the sequence in lower case characters.

EXAMPLE
         % bp_flanks ~/seq/ar.embl

         >1_/HOME/HEIKKI/SEQ/AR.EMBL oripos=100 strand=1 allelepos=100
         taataactcagttcttatttgcacctacttcagtggacactgaatttggaaggtggagga
         ttttgtttttttcttttaagatctgggcatcttttgaatCtacccttcaagtattaagag
         acagactgtgagcctagcagggcagatcttgtccaccgtgtgtcttcttctgcacgagac
         tttgaggctgtcagagcgct

TODO
       The input files are assumed to be in EMBL format and the sequences are
       retrieved only from the EMB database. Make this more generic and use
       the registry.

       head1 FEEDBACK

   Mailing Lists
       User feedback is an integral part of the evolution of this and other
       Bioperl modules. Send your comments and suggestions preferably to the
       Bioperl mailing lists  Your participation is much appreciated.

         bioperl-l@bioperl.org                  - General discussion
         http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track
       the bugs and their resolution.  Bug reports can be submitted via the
       web:

         https://github.com/bioperl/bioperl-live/issues

AUTHOR - Heikki Lehvaslaiho
       Email:  <heikki-at-bioperl-dot-org>

perl v5.20.2                      2015-09-15                      BP_FLANKS(1)